I am excited to share that FileMaker 12 has been released!  Please visit this link to learn more about the details of this long awaited release:

http://www.filemaker.com/products/filemaker-pro/whats-new.html?homepage=1-filemaker-pro

cf_reverse_complement( sequence )

Case(
Length ( sequence ) > 0 ;

Case(
Right ( sequence ; 1 )= “A”; “T”;
Right ( sequence ; 1 )= “T”; “A”;
Right ( sequence; 1 ) = “G” ; “C”;
Right ( sequence; 1 ) = “C”; “G” ;
“”
)

&
cf_reverse_complement ( Left ( sequence ; Length ( sequence ) – 1 ) )
)

Using the cf_reverse_complement function, the reverse complement for the EcoR1 cut site GAATTC  would output the sequence CTTAAG.  To see this in action download the FMB Oligo database from the Software page.

Charting a New Course

The chart object ( prior to its release, was a popularly requested feature by developers) is a new way to visually organize and display your data in FileMaker 11. Charting is to FileMaker 11 as Script Triggers were to FileMaker 10. Native charting, in FileMaker is faster than plug-in or web viewer based alternatives. There is still so much more FMI can do with charting… look for enhancements to the chart layout object in future release versions of FMP.  FileMaker has just scratched the surface with charting.

A chart is a layout object, therefore you can’t export a chart much like you can’t export tab control objects. Charts can be placed  in different layout parts (header, footer, body,etc.).  If a chart is placed in the header, it will display data from the record that you’re currently on or have open, otherwise it will default to the first record in the found set. Data used in charts must be delimited by carriage returns and the number of values in x and y column should be exact. Charts are dynamic in nature, when you update the data in a record the change will be reflected in the chart immediately.  If you hover over a chart value, a tool tip-like window will display values from the x and y column. You have the option to subsummarize your chart data as well, technically minimizing the number of bar or pie slices displayed in your chart object.

While you can’t export chart objects, there are ways to get charts out of FMP. For example you can take a picture clipping of the chart (drag and drop the chart to your desktop- Mac) or you can print/save the record(s) to PDF. You can also take advantage of the GetLayoutObjectAttribute function to return some bitmap information and an XML description about the chart object.

The chart layout object shows up in layout section of the Database Design Report.

Alexei also demonstrated Savvy Data’s SavvyData_ChartFun.

Some caveats about charts:

• there are no scatter plot charts
• no combination charts (line and bar charts)
• you can’t stack charts
• you can’t choose custom colors for graphs, need to choose from FileMaker’s predefined color pallet.

Google It in FM 11

What is Quick Find?  It is a multi-request find for every field on the layout. By default quick find is turned “on” for every field of every layout of every database.

In layout mode green magnifying badges in lower right corner of fields indicates that quick find is turned on and finds will generally be expeditious in manner.
Yellow magnifying lenses are cautionary and are attributed to unstored or related fields which can slow down a search. You can disable Quick Find in the layout set up dialog window.

FM 11′s Quick Find will build field indexes if they’re not already indexed when performing a find. Quick Find will also search on merge fields.

Inspector Gadget

The new Inspector allows you format layout objects in layout mode.  The Inspector has replaced some contextual right click menu items (e.g., right clicking on a field in FileMaker 11 we have lost “Text Format…”, “Date Format…”, “Field/Control”, “Set Sliding/Printing” and “Set Tooltip…”) for the “purpose” of speeding up the development of your solution. The Inspector can be opened in multiple instances allowing you to display each of the 3 inspector tabs (Position, Appearance and Data ) in a separate Inspector window.

Portal Power

FileMaker has introduced the portal filter feature to minimize the creation of new relationships to create subsets of data within a portal.  Aggregate calculations (for instance the Count function for calculating the total number of records being displayed in a portal) will not work for portals that have a filter applied to them. The Count function will calculate all the records for the base portal the filter is being applied to.  An interesting question raised during the session was, can you filter on unstored calcs? This question remains to be answered.

A caveat of the new portal filter feature is that if you use a Go To Related Record script step, it will display all the records based on the portal used for the filter.

Snapshot Link in a Snap

Snapshot link creates an XML file (.fpsl) all of the crucial information you’d like to share for a found set of records. Will Script Triggers fire (onRecordLoad and onLayoutEnter)? Yes they will, but the Snapshot link will also supply the information contained in the metafile to display the records it is supposed to display. So triggers will fire before the snapshot link displays its records.  Snapshot links are scriptable thanks to a script step.

You can open up a .fpsl file in a text editor (like TextMate and Dreamweaver) and edit the XML formatted values, however, there are chunks of information in the .fpsl file that you cannot describe with text, so you cannot create the files from scratch.

You will get an alert message when trying to restore data if you delete a record that was in the original found set of records when the snapshot link was created. Snapshot Links may replace commonly used opener files.

Some Things About Server

New in FileMaker Server 11 is the ability for an administrator to monitor individual client statistics, however, FileMaker server can take a performance hit when viewing too long.

FileMaker Server 11 Advanced sports new drivers for JDBC and ODBC  and, according to Alexei, they’re faster and more reliable.

A caveat about upgrading: make sure you run the uninstaller program in FM Server 10 before installing server 11.

I hope you find this information helpful, and happy FileMaking!

Evaluate( Substitute( list ; “¶” ; “+”)  )

This is a beautiful function.  I am in awe of its simplicity and power.

The name of the window is set in a previous script using the “New Window” script step. A local variable is employed to capture the name of the window using the Get( New Window ) function. The user is given a binary decision in the form of two buttons “Continue” or “Cancel” in the pop-up window.  Clicking on either will execute this code:

Script

Set Variable[ $_windowName ; Get( WindowName ) ]

// do something

Close Window [Name: $_windowName ; Current file ]

cf_DNA_Polymerase ( size )

The parameter “size”  is the number of bases that constitute the oligo.

Here is the custom function:

Let(

randomNum = Int ( Random * 100 );  // a randomly generated integer between  0 and 100

Case(   size > 0 ;

Case(
randomNum  ≥ 0 and randomNum     <  25 ; “A” ;
randomNum  ≥ 25 and randomNum   < 50 ;  “T” ;
randomNum  ≥ 50 and randomNum   < 75 ;  “G” ;
randomNum  ≥ 75 and randomNum    ≤ 100; “C” ;
) // end Case

&  cf_DNA_Polymerase( size – 1 );   // decrement the “size” parameter by one after each recursion

“”

) // end Case

) // end Let

So using a parameter for 100 should return a sequence like this:

cf_DNA_Polymerase ( 100 )

AGACTAACCTTGTTCGCATTCCCTGCGGTAGTCAAGATTACTCCCTAGCTACTTCCTAAAA

GCGTTCGGTTCCGCAGATTGTACTCTACTCCAGAGGCAG

Biology at work not pollutants.